ID: 1175702183_1175702192

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1175702183 1175702192
Species Human (GRCh38) Human (GRCh38)
Location 20:61147586-61147608 20:61147634-61147656
Sequence CCAGGAACATTCCAGAGTAGAGT CCCGCCACATGCCAGGCACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 18, 3: 90, 4: 465}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!