ID: 1175875442_1175875448

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1175875442 1175875448
Species Human (GRCh38) Human (GRCh38)
Location 20:62227377-62227399 20:62227399-62227421
Sequence CCAACAGAGCAGCACTGCCTGGG GGGGCCTCCGAGCCAAACCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!