ID: 1176015511_1176015528

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1176015511 1176015528
Species Human (GRCh38) Human (GRCh38)
Location 20:62929274-62929296 20:62929312-62929334
Sequence CCGCCGAGGCCACCGGGCAGCGT TGGGAGGGGAGCAGCGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 96} {0: 1, 1: 1, 2: 13, 3: 220, 4: 1894}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!