ID: 1176140775_1176140784

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1176140775 1176140784
Species Human (GRCh38) Human (GRCh38)
Location 20:63544150-63544172 20:63544169-63544191
Sequence CCTAGAGACCAACCACCCCAAGG AAGGTCAAGGGCCACTGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 187} {0: 1, 1: 0, 2: 2, 3: 15, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!