ID: 1176140781_1176140795

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1176140781 1176140795
Species Human (GRCh38) Human (GRCh38)
Location 20:63544165-63544187 20:63544191-63544213
Sequence CCCCAAGGTCAAGGGCCACTGAC GTGGGGGACAGAGGCAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 139} {0: 1, 1: 2, 2: 14, 3: 187, 4: 1311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!