ID: 1176140783_1176140790

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1176140783 1176140790
Species Human (GRCh38) Human (GRCh38)
Location 20:63544167-63544189 20:63544182-63544204
Sequence CCAAGGTCAAGGGCCACTGACCT ACTGACCTGGTGGGGGACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 192} {0: 1, 1: 0, 2: 0, 3: 35, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!