ID: 1176140783_1176140794

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1176140783 1176140794
Species Human (GRCh38) Human (GRCh38)
Location 20:63544167-63544189 20:63544190-63544212
Sequence CCAAGGTCAAGGGCCACTGACCT GGTGGGGGACAGAGGCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 192} {0: 1, 1: 0, 2: 17, 3: 167, 4: 1575}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!