ID: 1176206525_1176206531

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1176206525 1176206531
Species Human (GRCh38) Human (GRCh38)
Location 20:63891629-63891651 20:63891666-63891688
Sequence CCCTTGGGAGAGGCAGGCAGGGG AAAGGGCAGGTCCTCAATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 56, 4: 643} {0: 1, 1: 0, 2: 3, 3: 19, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!