ID: 1176206527_1176206535

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1176206527 1176206535
Species Human (GRCh38) Human (GRCh38)
Location 20:63891630-63891652 20:63891675-63891697
Sequence CCTTGGGAGAGGCAGGCAGGGGA GTCCTCAATGCTGGGACAAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 101, 4: 819} {0: 1, 1: 0, 2: 1, 3: 6, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!