ID: 1176248165_1176248168

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1176248165 1176248168
Species Human (GRCh38) Human (GRCh38)
Location 20:64107229-64107251 20:64107244-64107266
Sequence CCTCCCAAGCTCATCTCTGGCTC TCTGGCTCCCTTGAATCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 281} {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!