ID: 1176248165_1176248172

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1176248165 1176248172
Species Human (GRCh38) Human (GRCh38)
Location 20:64107229-64107251 20:64107258-64107280
Sequence CCTCCCAAGCTCATCTCTGGCTC ATCTGAAGGTCCTTCCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 281} {0: 1, 1: 0, 2: 1, 3: 5, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!