ID: 1176401721_1176401726

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1176401721 1176401726
Species Human (GRCh38) Human (GRCh38)
Location 21:6318756-6318778 21:6318769-6318791
Sequence CCACGTCCCGTCCGGCCCATCCG GGCCCATCCGGTCCTGTCCCTGG
Strand - +
Off-target summary No data {0: 7, 1: 6, 2: 0, 3: 8, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!