ID: 1176435430_1176435436

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1176435430 1176435436
Species Human (GRCh38) Human (GRCh38)
Location 21:6670334-6670356 21:6670348-6670370
Sequence CCCAGGGACAGGACCGGATGGGC CGGATGGGCCGGACGGGACGTGG
Strand - +
Off-target summary {0: 7, 1: 6, 2: 0, 3: 7, 4: 135} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!