ID: 1176436726_1176436736

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1176436726 1176436736
Species Human (GRCh38) Human (GRCh38)
Location 21:6679800-6679822 21:6679837-6679859
Sequence CCCCAATGCCTCCCGCAACTCTC GAAGATGCTCAGGAAGAACAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!