ID: 1176483253_1176483260

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1176483253 1176483260
Species Human (GRCh38) Human (GRCh38)
Location 21:7379182-7379204 21:7379197-7379219
Sequence CCCAGGGACAGGACCGGATGGGC GGATGGGCCGGACGGGACGTGGG
Strand - +
Off-target summary {0: 7, 1: 6, 2: 0, 3: 7, 4: 135} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!