ID: 1176553485_1176553496

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1176553485 1176553496
Species Human (GRCh38) Human (GRCh38)
Location 21:8242012-8242034 21:8242055-8242077
Sequence CCCCTCTGCGAGAAGACAGACGG TGGCAACAGGCTTTTTTGAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!