ID: 1176623965_1176623978

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1176623965 1176623978
Species Human (GRCh38) Human (GRCh38)
Location 21:9075636-9075658 21:9075674-9075696
Sequence CCTGCCAGCTGCAAACTCCCAAA ATGGGGTGAAGACACCCTGAAGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 3, 3: 27, 4: 319} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!