ID: 1176849543_1176849550

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1176849543 1176849550
Species Human (GRCh38) Human (GRCh38)
Location 21:13902233-13902255 21:13902262-13902284
Sequence CCAAGCTGTACCTGTGCATCTTT TGGCTGGTGCTGGAGCTGCAGGG
Strand - +
Off-target summary {0: 35, 1: 30, 2: 4, 3: 96, 4: 603} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!