ID: 1176983413_1176983419

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1176983413 1176983419
Species Human (GRCh38) Human (GRCh38)
Location 21:15408766-15408788 21:15408786-15408808
Sequence CCCTATGGGGTGCTGGGAAACAT CATGAGGAAGGCTGGCAAATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 28, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!