ID: 1177263975_1177263980

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1177263975 1177263980
Species Human (GRCh38) Human (GRCh38)
Location 21:18760117-18760139 21:18760153-18760175
Sequence CCGGAGGGATGGGAGTCAGCGGC CAGCAAACAGCAGTGGTGGACGG
Strand - +
Off-target summary {0: 4, 1: 34, 2: 91, 3: 116, 4: 216} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!