ID: 1177788223_1177788227

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1177788223 1177788227
Species Human (GRCh38) Human (GRCh38)
Location 21:25695468-25695490 21:25695485-25695507
Sequence CCCGTTCTCAATGAGCTGTTGGG GTTGGGTACACCTCCCAGACGGG
Strand - +
Off-target summary {0: 1398, 1: 571, 2: 139, 3: 41, 4: 130} {0: 990, 1: 915, 2: 379, 3: 77, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!