ID: 1177816644_1177816653

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1177816644 1177816653
Species Human (GRCh38) Human (GRCh38)
Location 21:25985384-25985406 21:25985427-25985449
Sequence CCTCCTCAACATGGGCAGGAATC GAAAACAAAAGGGCAGAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 31, 3: 305, 4: 1800}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!