ID: 1178064387_1178064393

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1178064387 1178064393
Species Human (GRCh38) Human (GRCh38)
Location 21:28888019-28888041 21:28888067-28888089
Sequence CCAAACACTGCACCACCAGTAGC TTTCTATTGTCACCAAACCCTGG
Strand - +
Off-target summary {0: 4, 1: 4, 2: 2, 3: 14, 4: 160} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!