ID: 1178303350_1178303358

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1178303350 1178303358
Species Human (GRCh38) Human (GRCh38)
Location 21:31470797-31470819 21:31470817-31470839
Sequence CCCAGGAGAAGAGAGAGGAACCG CCGGCAGGTGGTGGGTACCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 14, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!