ID: 1178489180_1178489183

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1178489180 1178489183
Species Human (GRCh38) Human (GRCh38)
Location 21:33037170-33037192 21:33037189-33037211
Sequence CCAGTGGAATCATATTCTGTTGT TTGTGGGTGTCTGCCACATTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!