ID: 1178489180_1178489185 |
View in Genome Browser |
Spacer: 16 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1178489180 | 1178489185 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 21:33037170-33037192 | 21:33037209-33037231 |
| Sequence | CCAGTGGAATCATATTCTGTTGT | TGGTTTATCCATTCATCTGTTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 34, 2: 206, 3: 449, 4: 886} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||