ID: 1178661672_1178661680

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1178661672 1178661680
Species Human (GRCh38) Human (GRCh38)
Location 21:34511833-34511855 21:34511852-34511874
Sequence CCCCTTCTCCATGTGCTTCTGCA TGCAGTTGGAAGAAGTGAGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!