ID: 1179154481_1179154490

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1179154481 1179154490
Species Human (GRCh38) Human (GRCh38)
Location 21:38838255-38838277 21:38838271-38838293
Sequence CCCCATGCTCCAACTGTCTCTGC TCTCTGCAGCCGGCTGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 215, 4: 3769} {0: 1, 1: 0, 2: 5, 3: 32, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!