|
Left Crispr |
Right Crispr |
| Crispr ID |
1179154482 |
1179154499 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
21:38838256-38838278
|
21:38838306-38838328
|
| Sequence |
CCCATGCTCCAACTGTCTCTGCA |
GGAAGGCTCTCTGGAGGAGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 1, 3: 20, 4: 188} |
{0: 1, 1: 19, 2: 161, 3: 563, 4: 1353} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|