ID: 1179422158_1179422168

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1179422158 1179422168
Species Human (GRCh38) Human (GRCh38)
Location 21:41245308-41245330 21:41245342-41245364
Sequence CCCTGGGTAGACTTGCCTATGCA AGTGGTTGGGGTGGCTCATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 79} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!