ID: 1179747602_1179747621

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1179747602 1179747621
Species Human (GRCh38) Human (GRCh38)
Location 21:43451580-43451602 21:43451633-43451655
Sequence CCAGCCCAGCCCCGAGAGCAGGA CGAGTGGGCCACGTGTAGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!