ID: 1179976833_1179976849

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1179976833 1179976849
Species Human (GRCh38) Human (GRCh38)
Location 21:44873292-44873314 21:44873333-44873355
Sequence CCCTGCCCGCGCCCCAGCCGCGA CCAAACGGGCGTGACCCTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 278} {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!