ID: 1179976834_1179976851

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1179976834 1179976851
Species Human (GRCh38) Human (GRCh38)
Location 21:44873293-44873315 21:44873346-44873368
Sequence CCTGCCCGCGCCCCAGCCGCGAC ACCCTCGAGGAGCCTCCGTCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 61, 4: 634} {0: 1, 1: 0, 2: 2, 3: 4, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!