ID: 1179976838_1179976853

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1179976838 1179976853
Species Human (GRCh38) Human (GRCh38)
Location 21:44873303-44873325 21:44873347-44873369
Sequence CCCCAGCCGCGACGGCAGCTCCC CCCTCGAGGAGCCTCCGTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 197} {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!