ID: 1180014838_1180014851

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1180014838 1180014851
Species Human (GRCh38) Human (GRCh38)
Location 21:45075045-45075067 21:45075085-45075107
Sequence CCGAGGGCGCCGAGTCCGCGTGG CGCGGGGAGGGCAGGTGCGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 32, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!