ID: 1180042576_1180042585

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1180042576 1180042585
Species Human (GRCh38) Human (GRCh38)
Location 21:45287804-45287826 21:45287851-45287873
Sequence CCGGAGGCAGAAGCCGGAGGCCA GACGAAGCTGAGTGTCGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 298} {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!