ID: 1180042578_1180042588

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1180042578 1180042588
Species Human (GRCh38) Human (GRCh38)
Location 21:45287817-45287839 21:45287861-45287883
Sequence CCGGAGGCCAGGACACTGCCCCC AGTGTCGCCATGGCCCCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 397} {0: 1, 1: 0, 2: 1, 3: 7, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!