ID: 1180042583_1180042594

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1180042583 1180042594
Species Human (GRCh38) Human (GRCh38)
Location 21:45287837-45287859 21:45287878-45287900
Sequence CCCAGCAGCAGGAAGACGAAGCT GGGCGGCCACGCACTTCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 211} {0: 1, 1: 0, 2: 1, 3: 7, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!