ID: 1180049310_1180049335

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1180049310 1180049335
Species Human (GRCh38) Human (GRCh38)
Location 21:45324124-45324146 21:45324173-45324195
Sequence CCTCCCTCCCAACCCTCAGCCTC TGAGCCTGCTGTGAGGAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 18, 3: 239, 4: 1960} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!