ID: 1180049311_1180049331

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1180049311 1180049331
Species Human (GRCh38) Human (GRCh38)
Location 21:45324127-45324149 21:45324169-45324191
Sequence CCCTCCCAACCCTCAGCCTCCCC GAGCTGAGCCTGCTGTGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 160, 4: 1525} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!