ID: 1180110130_1180110140

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1180110130 1180110140
Species Human (GRCh38) Human (GRCh38)
Location 21:45643607-45643629 21:45643647-45643669
Sequence CCCTTGGGCGGGGGCGGGGCCGG AGATTGGTTAGCGGCGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 82, 4: 519} {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!