ID: 1180110132_1180110142

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1180110132 1180110142
Species Human (GRCh38) Human (GRCh38)
Location 21:45643608-45643630 21:45643651-45643673
Sequence CCTTGGGCGGGGGCGGGGCCGGC TGGTTAGCGGCGCAGAGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 146, 4: 877} {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!