ID: 1180175320_1180175337

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1180175320 1180175337
Species Human (GRCh38) Human (GRCh38)
Location 21:46084387-46084409 21:46084430-46084452
Sequence CCGTGTTCCCGTCTGAACCCTCC GAGGGGCTACCAGCCAGACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 177} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!