ID: 1180308753_1180308759

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1180308753 1180308759
Species Human (GRCh38) Human (GRCh38)
Location 22:11151434-11151456 22:11151465-11151487
Sequence CCCACTGGCCCCTAGCTAGAGGT GACTTTGAAACATGAACAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!