ID: 1180314344_1180314355

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1180314344 1180314355
Species Human (GRCh38) Human (GRCh38)
Location 22:11265006-11265028 22:11265034-11265056
Sequence CCCACCTAACTGACTCACTAAAT TAAAGGGACGTGGGTAGTGGGGG
Strand - +
Off-target summary No data {0: 7, 1: 6, 2: 3, 3: 13, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!