ID: 1180482804_1180482807

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1180482804 1180482807
Species Human (GRCh38) Human (GRCh38)
Location 22:15770633-15770655 22:15770655-15770677
Sequence CCATCCCAGCAACAAATCGACAA ACTCAGCCAGCACTAAAAGTTGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 1, 3: 19, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!