ID: 1180811562_1180811563 |
View in Genome Browser |
Spacer: -8 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1180811562 | 1180811563 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 22:18765929-18765951 | 22:18765944-18765966 |
| Sequence | CCTGCTTCTCTGGGAAACCTCAG | AACCTCAGTTTTTGTTCTTAAGG |
| Strand | - | + |
| Off-target summary | {0: 8, 1: 3, 2: 16, 3: 66, 4: 443} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||