|
Left Crispr |
Right Crispr |
Crispr ID |
1180811562 |
1180811567 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
22:18765929-18765951
|
22:18765965-18765987
|
Sequence |
CCTGCTTCTCTGGGAAACCTCAG |
GGCCTTCAACTGATTGGAGGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 8, 1: 3, 2: 16, 3: 66, 4: 443} |
{0: 13, 1: 172, 2: 500, 3: 826, 4: 980} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|