ID: 1181036156_1181036165

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1181036156 1181036165
Species Human (GRCh38) Human (GRCh38)
Location 22:20170652-20170674 22:20170687-20170709
Sequence CCAGCCTCAGCAGAGAAGCAAGG TAGAACATCAAGGCGGAAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 17, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!