ID: 1181066336_1181066344

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1181066336 1181066344
Species Human (GRCh38) Human (GRCh38)
Location 22:20307779-20307801 22:20307812-20307834
Sequence CCCACAGGATGCCTATGACAATG CATGGAGCTGGCTCACCGTGAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 9, 4: 149} {0: 1, 1: 0, 2: 2, 3: 16, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!